FictionPress.com - let the words flow
Home Just In Communities Forums Beta Readers Dictionary Search Login Register Extras
Queen Jay
hide bio
Feed . Send Message. Subscribe . Favorite
email: Email
since: 11-12-05, id: 501343
country: United States
Author has written 2 stories for Fantasy.

//Agent Profile
Codename: Jay
Number: 0042
DNA sequence: AGCTAAGTCGGTCTAGAGTTCATCAGATCGG
Fingerprint: whorl, left wave, right cha-cha, spiral, haiku down, dodge right dash left
Partner in Crime: Finch

Sort: Category . Published . Updated . Title . Words . Chapters . Reviews . Status .

1. HMS Deceit reviews
Ships, swordfighting, pirates, and treasure. The captain of the H.M.S. Deceit takes on an interesting passenger who is either a keeping a dastardly secret, b on the run for her life, or c a houseplant in disguise. T for language.
Fantasy - Fiction Rated: T - English - Romance/Adventure - Chapters: 1 - Words: 1,925 - Reviews: 2 - Updated: 1-12-08 - Published: 1-12-08
2. The Princess and the Dragon reviews
A short story about a hireling dragon and his time in the service of a princess. Ah, good times. Yea verily.
Complete - Fantasy - Fiction Rated: K - English - Fantasy/Adventure - Chapters: 1 - Words: 4,183 - Reviews: 1 - Updated: 12-16-05 - Published: 12-16-05
Return to Top