Eia was a happy child. Like most children of her age, she was surrounded by friends, and teachers who cared for her and loved her. She was quiet, but was an obedient, and never let other children or adults tear her down.

The teachers seemed to condition each child to write their name and a special number on every paper they received or handed in. She scribbled on the top. "Name; Eia N. Number: 1905374K"

One day she decided to know what would happen if she didn't write anything on the top of her paper. What would happen, if anything was to happen at all? It was that day, when she asked the forbidden question to the class. "Who am I?"

The teacher didn't know what to say at first. She gave a slight smile in a petrified way "Why, you're Eia!" Her teacher said, with a terrified look on her face. How could a little one ask the question she asked. "We don't ask stupid question like that here, E. You know that!"

"But!" She cried out. "Sometimes I wonder..." She looked to her teacher in awe. Sometimes you have to wonder, because if you don't, nothing will ever change. "What's my last name?" Eia asked.

The teacher stared into her eyes as if she saw a ghost. "What…what do you mean 'last name'?" The teacher stuttered. "There are no such things as last names, only last letters." She looked at the girl's tilted head. "And your last letter is 'N'!"

Eia didn't seem to take that for an answer. "But what does the 'N' mean?" She demanded.

"It's just how we define you, E." The teacher gave her a comforting smile which seemed to try to ease her mind. "You know that!"

Eis looked down to the silver chain hanging from her neck. Two shiny silver plated rings seemed to swing as she moved around in a trug. "What is this?" She asked her teacher "Why do I have this and not a bracelet like Nicki H, has, or a watch like Freddy M has?" She asked.

The teacher mind held silent. She herself didn't know the truth about every question the little girl had inquired. The truth about the history and the story was all a mystery to both of them. "That's enough! E, go back outside!" The teacher screamed at E. Maybe if the girl went outside it would clear her mind of these forbidden questions.

In this world, you aren't supposed to ask about your history. You don't worry about your story. You are only one person in the big world and you don't let arbitrary things like family clutter your mind.

The day passed on, and the days of wonder turned to weeks, and the weeks lead up to a year. Every year that passed she would ask these questions to her next teacher. And every year the teacher would tell her to leave. But one afternoon, Eis found the answer she was looking for, an address to a library that was rumored to hold all truths.

With every last penny she saved, she turned to the place that she discovered on that book page. Sneaking in through big locked doors and tall stacks of books she has never heard of before. The shelves lined the halls and seemed as though they reached up to the stars. "Hello" she asked out. No answer.

"What do you wish, my child" A voice cried from afar. She followed the voice to a large desk with a large chair turned with its back to her.

"Can you help me?" Eia asked.

The man turned around in his tall chair. "Please.." She pouted. She walked up a bit closer,m standing just behind the large desk separating them. She looked up at the big wrinkled face, which seemed to grin at her. Holding back the tears of fright as she tried to stand tall.

"The question is little miss…" He looked at her through narrow eyes. "...how can you help me?" He gaze guided down to the silver chain around the girl's neck. The two rings on the necklace laying flesh with her neck.

She moved her hands towards the cold metal. As she pulled the necklace off, tears began to fall down her fragile face. She held it up as an offering.

The man snacthed the chian with great speed and grinned as he looked at the shiny metal. "Now that's that settled, what may I offer you in return?" He asked, even though she already knew what she wanted.

Eia wiped the tears from her eyes and took a deep breath. "I want my records…". She tugged on her shirt and held her chin up high "Tell me my story.."

"Are you sure you understand the repercussions of this?" He asked her with a cynical tone paired with a wide grin. She swallowed and nodded. His hand guided her to case of books, one in particular caught her eye. It's title, Trial 1905374K. Its spine seemed as if it was made of the same silver the necklace was made out of.

Without hesitation she ran over to the book. With tears of joy running down her face, she opened the pages. She finally was going to learn her story, the story she was so desperately trying to learn for years.

" Trial number 1905374K. Code Name: Eia N."

She stared at the words the bore her name and number, and the sequence of genetic coding that followed after. A strip of almost meaningless letters strong in a line. ACCTTGACGTTAGCTAGCCTGAATC… On every page, a red stamped "Failure" was placed.