Queen Jay
hide bio
PM . Follow . Favorite
Joined 11-12-05, id: 501343
Author has written 2 stories for Fantasy.

//Agent Profile
Codename: Jay
Number: 0042
DNA sequence: AGCTAAGTCGGTCTAGAGTTCATCAGATCGG
Fingerprint: whorl, left wave, right cha-cha, spiral, haiku down, dodge right dash left
Partner in Crime: Finch

Sort: Category . Published . Updated . Title . Words . Chapters . Reviews . Status .

The Trampled Rose by Finch the Touch reviews
Everyone knows the story of the Sleeping Princess, but what happens Ever After? What if she wasn't fond of being kissed by a complete stranger? How can a country thrown 100 years ahead cope? Please, reviews/flames/criticisms are greatly appreciated!
Fiction: Fantasy - Rated: K+ - English - Romance/Humor - Chapters: 5 - Words: 7,952 - Reviews: 8 - Favs: 4 - Updated: 8/25/2008 - Published: 1/5/2008
Letters from a toothpick fiend by Plinky reviews
Sophia, 17, mad as a demented bucket, writes a bunch of thoughts and sends them to a random address, because ... well, just because. What happens, though, when someone writes back? And who's the hot new guy at school?
Fiction: Romance - Rated: T - English - Humor/Romance - Chapters: 36 - Words: 86,688 - Reviews: 1532 - Favs: 459 - Follows: 163 - Updated: 8/25/2006 - Published: 11/7/2005
Shades of Gray by Finch the Touch reviews
A jewel is stolen, a war is begun. But when Aaralyn's side comes out the loser, and she is captured, what is to be done? Reposted with new stuff!
Fiction: Fantasy - Rated: T - English - Adventure/Romance - Chapters: 1 - Words: 3,163 - Reviews: 4 - Favs: 2 - Published: 6/22/2005
Keeping the Rain by Finch the Touch reviews
A short story about a cripple a horse and some rain. Please R&R
Fiction: General - Rated: K - English - Drama - Chapters: 1 - Words: 1,232 - Reviews: 4 - Favs: 1 - Published: 2/22/2005
Sort: Category . Published . Updated . Title . Words . Chapters . Reviews . Status .

HMS Deceit reviews
Ships, swordfighting, pirates, and treasure. The captain of the H.M.S. Deceit takes on an interesting passenger who is either a keeping a dastardly secret, b on the run for her life, or c a houseplant in disguise. T for language.
Fiction: Fantasy - Rated: T - English - Romance/Adventure - Chapters: 1 - Words: 2,052 - Reviews: 2 - Favs: 2 - Follows: 1 - Published: 1/12/2008
The Princess and the Dragon reviews
A short story about a hireling dragon and his time in the service of a princess. Ah, good times. Yea verily.
Fiction: Fantasy - Rated: K - English - Fantasy/Adventure - Chapters: 1 - Words: 4,305 - Reviews: 1 - Favs: 4 - Published: 12/16/2005 - Complete